whole human genome dna microarray 4× 44k v2 slides  (Agilent technologies)

Journal: Vaccines

Article Title: Molecular Events in Immune Responses to Sublingual Influenza Vaccine with Hemagglutinin Antigen and Poly(I:C) Adjuvant in Nonhuman Primates, Cynomolgus Macaques

doi: 10.3390/vaccines12060643

Figure Lengend Snippet: Points in time for sublingual vaccinations and assessments of anti-HA (hemagglutinin) antibodies, blood tests, plasma cytokines, quantitative reverse transcription PCR (RT-qPCR), and DNA microarray analyses. RT-qPCR and DNA microarray analyses were conducted with RNA isolated from white blood cells (WBC). Vaccinations were performed four times at 0 (1st), 6 (2nd), 18 (3rd), and 30 (4th) weeks. Arrows indicate sampling timepoints for each assay.

Article Snippet: The labeled cRNA was subsequently fragmented using the Gene Expression Hybridization Kit (Agilent Technologies, Santa Clara, CA, USA) and then set onto Whole Human Genome DNA Microarray 4× 44K v2 slides (Agilent Technologies, Santa Clara, CA, USA).

Techniques: Reverse Transcription, Quantitative RT-PCR, Microarray, Isolation, Sampling

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Labeled cRNA samples were applied on the DNA microarray slides (44k whole human genome, G4112F, Agilent).

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Radiation research

Article Title: RENEB Inter-Laboratory Comparison 2021: The Gene Expression Assay

doi: 10.1667/RADE-22-00206.1

Figure Lengend Snippet: Overview of Methodological Details of Either qRT-PCR (Quantitative Reverse Transcription Polymerase Chain Reaction) or Microarrays Used by the Contributing Teams

Article Snippet: Additionally, all column RNA prep kits remove most of the DNA. (−) RT control conventional PCR (ß-actin primer, HotStar MasterMix (Qiagen), 30 cycles) Check DNA conta mination No cDNA synthesis cDNA synthesis Kit/MasterMix High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) QuantiTect Reverse Transcription (Qiagen) High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) High Capacity cDNA Archive Kit High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) Kit/MasterMix Quick Amp Labeling Kit (Agilent) PCR protocol 1× /25°C/10min, 1×/37°C/ 120min, 1×/85°C/5min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/42°C/2min, 1×/42°C/20min, 1×/95°C/3min 1×/25°C/10min, 1×/37°C/120min, 1×/85°C/5min 1×/25°C/5min, 1×/42°C/60min, 1×/l0°C/5min 1×/25°C/10min, 1×/37°C/120min, 1× /85°C/5min 1×/25°C/10min, 1×/37°C/120min PCR protocol 1×/40°C/120min, 1×/70°C/15min; 1 × /40°C/120min Quality control UBC Ct ITFG1 Ct, DPM1 Ct MRPS5 Ct No HPRT1 Ct 18S rRNA Ct Quality control NanoDrop ™ qRT-PCR Kit/MasterMix TaqMan Universal Master Mix TaqMan Universal Master Mix II, no UNG (Thermo Fisher Scientific) QuantiFast SYBR Green PCR (Qiagen) 5X HOT FIREPol ® EvaGreen ® qPCR SuperMix, Solis BioDyne TaqMan fast advanced master mix (Applied Biosystems) and Maxima SYBR Green qPCR Master Mix (Thermo Scientific) TaqMan,PerfeCTa ® , MultiPlex qPCR SuperMix, Quanta bioscience TaqMan Universal Master Mix Microarray DNA-Microarray Agilent, 44k whole human genome, G4112F TaqMan assays SYBR Green assay FDXR (Hs00244586_ml), GDF15 (Hs00171132_ml) BAX (Hs00180269_ml), BBC3 (Hs00248075_ml), CDKN1A (Hs00355782_ml), DDB2 (Hs03044953_ml), FDXR (Hs00244586_ml), GADD45A (Hs00169255_ml), GDF15 (Hs00171132_ml), TNFSF4 (Hs00182411_ml) CDKN1A-F: AGACCAGCATGACAGATTTCTACC; CDKN1A-R: CTTCCTGTGGGCGGATTAGG; DDB2-F: AGCATCACTGGGCTGAAGTT; DDB2-R: TGGTGTCTGAGCTGGCAAAA; FDX-F: TGGAGAGAACGGACATCACG; FDX-R: AGCCACACTGTCTTCACTCG GADD45a for: ACTGCGTGCTGGTGACGAAT, GADD45a rev: GTTGACTTAAGGCAGGATCCTTCCA; FDXR for: TGGATGTGCCAGGCCTCTAC, FDXR rev: TGAGGAAGCTGTCAGTCATGGTT; CDKN1A for: CCTGGAGACTCTCAGGGTCGAAA, CDKN1A rev: GCGTTTGGAGTGGTAGAAATCTGTCA; MDM2 for: TATCAGGCAGGGGAGAGTGATACA, MDM2 rev: CCAACATCTGTTGCAATGTGATGGAA; 18S for: GCTTAATTTGACTCAACACGGGA, 18S rev: AGCTATCAATCTGTCAATCCTGTCC.

Techniques: Reverse Transcription, Polymerase Chain Reaction, Microarray, Isolation, Lysis, Concentration Assay, Sequencing, Labeling, SYBR Green Assay, Multiplex Assay, TaqMan Assay, Real-time Polymerase Chain Reaction, Software, Extraction

Journal: Journal of proteomics & bioinformatics

Article Title: Gene Expression Profiling of Gastric Cancer

doi:

Figure Lengend Snippet: Representative sections from tissue microarrays for normal gastric tissues and tumor tissues stained with anti-villin-1 antibody are shown.

Article Snippet: Fragmented Cy3-labeled cRNA of the control sample was mixed with equal amounts of Cy5-labeled cRNA from the gastric tumor sample and the mixtures hybridized onto 44K whole human genome DNA microarrays (G4112F, 4x44K, Agilent Technologies) for 17 hrs at 65°C with constant rotation (10 rpm).

Techniques: Staining

Journal: Journal of proteomics & bioinformatics

Article Title: Gene Expression Profiling of Gastric Cancer

doi:

Figure Lengend Snippet: Representative sections from tissue microarrays for normal gastric mucosa and gastric adenocarcinoma stained with anti-testican-1 antibody are shown.

Article Snippet: Fragmented Cy3-labeled cRNA of the control sample was mixed with equal amounts of Cy5-labeled cRNA from the gastric tumor sample and the mixtures hybridized onto 44K whole human genome DNA microarrays (G4112F, 4x44K, Agilent Technologies) for 17 hrs at 65°C with constant rotation (10 rpm).

Techniques: Staining